rs12569 chr20:31861378 G>A
- Sequence
ccccgaagggagccagtcggaagt[G/A]gggagccacggctggactgcatcc
- ASB in cell types
- breast tumor tissue
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor tissue | 1.88 | n/a | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Caudate_basal_ganglia, Brain_Nucleus_accumbens_basal_ganglia, Esophagus_Muscularis, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Spleen, Testis