rs12569831 chr10:33478619 G>A
- Sequence
gacttgaaatgccagaggtttact[G/A]caagtctgagacagaaaagaagga
- ASB in cell types
- LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | 0.65 | 0.10 | 1.39 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, eye color, infant head circumference, late onset alzheimers disease, microalbuminuria, neuroblastoma (brain cancer), paternal transmission distortion, sporadic creutzfeldt-jakob disease, total cholesterol, transmission distortion, triglycerides, urinary albumin-to-creatinine ratio