rs12592319 chr15:92845158 T>C
- Sequence
cattctttcctcaacctctcccct[T/C]actcctgctttgtactttgtatct
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) GM12878 (female B-cells)
- ASB for transcription factors
- FOXK2_HUMAN IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | 1.50 | -1.01 | 1.78 | n/a | n/a | |||
| IKZF2_HUMAN | 1.63 | -0.23 | 1.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, hdl cholesterol change with statins, ldl cholesterol change with statins, total cholesterol change with statins