rs12596655 chr16:84325102 T>C
- Sequence
tttattccttcatccctccatcca[T/C]ccatcctttcatttacttacctat
- ASB in cell types
- HEK293 (embryonic kidney) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.04 | 0.64 | 1.69 | |||
| HepG2 (hepatoblastoma) | 0.88 | -0.09 | 2.00 |
Items per page:
1 – 2 of 2