rs12600372 chr17:82351635 G>A
- Sequence
gctctcacacacaaacatgcactc[G/A]caataggcctccagggctggggcc
- ASB in cell types
- GM12878 (female B-cells) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.27 | 0.52 | 1.30 | |||
| HepG2 (hepatoblastoma) | -0.20 | 0.52 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Brain_Cerebellum, Heart_Atrial_Appendage, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Thyroid