rs12601992 chr17:71572939 T>G
- Sequence
acaagttgccaggatatacttctc[T/G]tatttacatagcttaaagcaaata
- ASB in cell types
- VCaP (prostate carcinoma) ZR-75-1 (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | 1.56 | -0.32 | 1.89 | |||
| ZR-75-1 (invasive ductal carcinoma) | -0.52 | 1.55 | 2.00 |
Items per page:
1 – 2 of 2