rs12612238 chr2:112667055 G>A
- Sequence
tctgttactcagttcactccagat[G/A]agaaagcttttggttgtgttgcct
- ASB in cell types
- K562 (myelogenous leukemia) CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- PKNX1_HUMAN NFIC_HUMAN HTF4_HUMAN HDAC2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PKNX1_HUMAN | n/a | 3.96 | 2.00 | n/a | No Hit | |||
| NFIC_HUMAN | n/a | 3.41 | 2.00 | n/a | No Hit | |||
| HTF4_HUMAN | n/a | 3.43 | 2.00 | n/a | No Hit | |||
| HDAC2_HUMAN | -3.45 | 3.09 | 2.00 | n/a | n/a | |||
| KDM1A_HUMAN | n/a | 3.01 | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 30
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Colon_Transverse, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood