rs12613672 chr2:37833036 A>G
- Sequence
tgctcagagctaagtcaacattcc[A/G]ggtgagacatgaccagggcccagg
- ASB in cell types
- LNCaP (prostate carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.22 | 0.79 | 1.52 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), late onset alzheimers disease, resistance to kuru in aged women despite likely exposure, salmonella-induced pyroptosis, systolic blood pressure (sbp)
GTEx eQTL Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Lung, Nerve_Tibial, Spleen, Whole_Blood