rs12614621 chr2:200306484 G>C
- Sequence
gaaaggagctagggagggcgtgtg[G/C]agggacgagatctgtgtcagaacg
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells) MCF7 (Invasive ductal breast carcinoma) HEK293T (embryonic kidney)
- ASB for transcription factors
- ZN398_HUMAN FOXK2_HUMAN PKNX1_HUMAN ZFX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN398_HUMAN | 1.58 | -1.86 | 1.33 | n/a | n/a | |||
| FOXK2_HUMAN | 0.05 | 1.99 | 1.61 | n/a | n/a | |||
| PKNX1_HUMAN | -0.37 | 1.78 | 1.44 | n/a | No Hit | |||
| ZFX_HUMAN | 0.33 | 1.27 | 1.62 | n/a | No Hit | |||
| BHE40_HUMAN | -1.22 | 1.59 | 1.33 | n/a | No Hit |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cortex, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood