rs12615784 chr2:9649274 T>C
- Sequence
cctttgaggtgtttgctattgtcc[T/C]ggcacttggcaaacacatgataaa
- ASB in cell types
- BT-474 (breast invasive ductal carcinoma) SK-BR-3 (breast adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| BT-474 (breast invasive ductal carcinoma) | 1.82 | -1.38 | 2.75 | |||
| SK-BR-3 (breast adenocarcinoma) | -0.97 | 1.24 | 1.50 |
Items per page:
1 – 2 of 2