rs12622636 chr2:184459882 G>A
- Sequence
atattactggtttatgtatttact[G/A]tactttttatctacatatgaaaac
- ASB in cell types
- LHSAR (prostate epithelial cells) LNCaP (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.88 | -2.17 | 1.50 | n/a | No Hit | |||
| FOXA1_HUMAN | 1.35 | -0.78 | 1.67 | -1.24 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP college completion, hdl cholesterol, obesity with early age of onset (age >2), years of education