rs12629052 chr3:23095252 C>G
- Sequence
cctaacaggtgaagaataatggct[C/G]tacactatgaccacatttttccca
- ASB in cell types
- HEK293 (embryonic kidney) T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.58 | 0.33 | 1.69 | |||
| T47D (invasive ductal carcinoma) | -0.33 | 0.87 | 1.50 |
Items per page:
1 – 2 of 2