rs12631514 chr3:12796794 G>C
- Sequence
ccagcgacaaggacttcaggtgca[G/C]cccgccgccggcccccttctctcc
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- PRDM4_HUMAN ZFHX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRDM4_HUMAN | -2.78 | 2.07 | 1.50 | n/a | n/a | |||
| ZFHX2_HUMAN | -1.83 | 1.90 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Esophagus_Mucosa, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid