rs12637184 chr3:169769649 G>A
- Sequence
gggtgaggccagagtcctgggggc[G/A]caggcagggggtcggcagggcccc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.15 | 0.72 | 1.50 | |||
| A549 (lung carcinoma) | -0.15 | 0.94 | 2.05 |
Items per page:
1 – 2 of 2