rs12658664 chr5:179559986 C>T
- Sequence
cccggagtctgacctccccacgct[C/T]agtccactaacgaagctatccctg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.64 | 1.12 | 3.07 | |||
| GM12878 (female B-cells) | 0.97 | -0.02 | 1.27 | |||
| A549 (lung carcinoma) | -0.63 | 0.86 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Pancreas, Spleen, Testis, Thyroid, Whole_Blood