rs12663047 chr6:131639758 A>G
- Sequence
gtgcacagtgtaacatagtttaag[A/G]tacatgtgcaccccaatatcaaga
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.60 | -0.25 | 1.97 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), diabetic retinopathy in type 2 diabetes mellitus, fasting blood glucose, hdl cholesterol, ldl cholesterol, total cholesterol
GTEx eQTL Adipose_Visceral_Omentum, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Whole_Blood