rs1267311 chr1:46521416 A>T
- Sequence
gcctgcctcagcctccccaagtgc[A/T]gggattacaggtgtaagccacagt
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.44 | 0.45 | 1.26 | |||
| HEK293 (embryonic kidney) | -0.25 | 0.36 | 1.98 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Lung, Thyroid, Whole_Blood