rs12676354 chr8:26295051 T>G
- Sequence
gttgtgtattactcatgttgtaac[T/G]acattacctgttgaatagtaaaca
- ASB in cell types
- HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.76 | -0.02 | 1.82 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.20 | 1.00 | 1.37 |
Items per page:
1 – 2 of 2