rs12682500 chr8:120868895 G>A
- Sequence
gaagaagaaaaaaaaaaaggaact[G/A]aggtacagaaatcggaagtgaggt
- ASB in cell types
- HepG2 (hepatoblastoma) RWPE1 (prostate epithelial cells) erythroid cells GM12878 (female B-cells)
- ASB for transcription factors
- GABPA_HUMAN CTCF_HUMAN RAD21_HUMAN CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GABPA_HUMAN | 2.24 | -0.22 | 1.61 | -1.09 | Weak Concordant | |||
| CTCF_HUMAN | 1.02 | 0.69 | 1.32 | n/a | No Hit | |||
| RAD21_HUMAN | 0.95 | -0.12 | 1.40 | n/a | n/a | |||
| CREB1_HUMAN | 1.08 | 0.28 | 1.42 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GRASP 2 hour glucose, college completion, fasting blood glucose, hdl cholesterol, homa-b, major depressive disorder (narrow definition), major depressive disorder (narrow definition) (males), total cholesterol, years of education