rs1268843 chr14:93178034 A>C
- Sequence
tttggtgaggccaggcctctctga[A/C]cagtgaattagaagattctagaat
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | -0.92 | 1.24 | 1.81 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, advanced age-related macular degeneration (geographic atrophy), endometriosis, hypertension (early onset hypertension), systolic blood pressure (sbp), tetrology of fallot