rs126907 chr20:50113140 C>G
- Sequence
tggtggctgccatcttgcgtcgct[C/G]ttgcttgaaggccggccccttctt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) K562 (myelogenous leukemia) H1 (embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.47 | -0.64 | 3.69 | |||
| K562 (myelogenous leukemia) | n/a | 2.54 | 2.00 | |||
| H1 (embryonic stem cells) | 1.15 | -0.30 | 1.39 |
Items per page:
1 – 3 of 3