rs12699256 chr7:11726536 C>G
- Sequence
ctgaggtctgcatgcagacagatg[C/G]ccagaattgattttttttgcaccc
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.18 | 0.86 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, childhood acute lymphoblastic leukemia, hdl cholesterol, obesity with early age of onset (age >2), total cholesterol