rs12702450 chr7:1170001 C>A
- Sequence
cctctgtgccgccatgttccctcc[C/A]ggccacgcccccttgcaacccctc
- ASB in cell types
- MM1.S (plasma cell myeloma) GM12878 (female B-cells) A673 (Ewing sarcoma) liver
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MM1.S (plasma cell myeloma) | 1.19 | -0.10 | 1.37 | |||
| GM12878 (female B-cells) | 0.53 | 0.45 | 1.36 | |||
| A673 (Ewing sarcoma) | -1.65 | 1.98 | 1.33 | |||
| liver | 1.02 | -0.46 | 1.33 | |||
| H1 (embryonic stem cells) | 0.65 | -0.23 | 1.33 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood