rs12702743 chr7:8418828 C>T
- Sequence
gtttcataggtgaactgggctata[C/T]catcatatggcaaacactaggtgg
- ASB in cell types
- foreskin keratinocyte SK-N-SH (neuroblastoma) right lobe of liver
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.51 | n/a | 2.67 | |||
| SK-N-SH (neuroblastoma) | -0.43 | 1.21 | 2.00 | |||
| right lobe of liver | 1.06 | -1.34 | 1.33 |
Items per page:
1 – 3 of 3