rs12705420 chr7:107742688 T>C
- Sequence
gaaaataatcaccaaataacatgg[T/C]gcacttaaatcgcactgatcatca
- ASB in cell types
- LNCaP (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.92 | 0.19 | 1.48 | -0.30 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP adiponectin levels, chronic kidney disease, fasting insulin, hdl cholesterol, homa-b, homa-ir, major depressive disorder (narrow definition), major depressive disorder (narrow definition) (males), parkinsons disease, paternal transmission distortion, recurrent early onset major depressive disorder, recurrent early onset major depressive disorder (males)