rs12709094 chr16:89786609 A>G
- Sequence
gggattacaggcatgaactatcac[A/G]cctgaccatgtgtagattcttttg
- ASB in cell types
- K562 (myelogenous leukemia) CD34+ hematopoietic stem cells-derived proerythroblasts CD34+ bone marrow cell-derived erythroid progenitors
- ASB for transcription factors
- RING2_HUMAN MTG8R_HUMAN MGAP_HUMAN GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RING2_HUMAN | n/a | 3.19 | 2.00 | n/a | n/a | |||
| MTG8R_HUMAN | n/a | 3.28 | 2.50 | n/a | n/a | |||
| MGAP_HUMAN | n/a | 3.06 | 2.00 | n/a | n/a | |||
| GATA1_HUMAN | -1.58 | 1.95 | 1.94 | n/a | No Hit | |||
| NCOR1_HUMAN | -0.83 | 2.78 | 3.50 | n/a | n/a |
Items per page:
1 – 5 of 14
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Uterus, Whole_Blood