rs12714237 chr2:28567017 G>A
- Sequence
gctccgcttccgacagtgacgaaa[G/A]ccttagagttgggggtggaacgag
- ASB in cell types
- foreskin keratinocyte MM1.S (plasma cell myeloma) B-cells 786-O (renal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.41 | n/a | 2.67 | |||
| MM1.S (plasma cell myeloma) | 1.69 | -0.18 | 1.33 | |||
| B-cells | 2.04 | n/a | 2.00 | |||
| 786-O (renal carcinoma) | 1.77 | -2.05 | 1.50 |
Items per page:
1 – 4 of 4