rs12719654 chr7:154584676 G>T
- Sequence
ccttcttaaatgcacttctgttaa[G/T]ctgtgcatgtaagaggtctgttct
- ASB in cell types
- RWPE2
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.19 | -0.24 | 1.44 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), hdl cholesterol change with statins, ldl cholesterol change with statins, rheumatoid arthritis, systolic blood pressure (sbp)