rs12720216 chr19:10380684 T>G
- Sequence
tggatttttttttttttgccatgg[T/G]ggcggcactctcattggtcctggg
- ASB in cell types
- HEK293 (embryonic kidney) liver MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- SP1_HUMAN PATZ1_HUMAN RFX5_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SP1_HUMAN | 2.92 | -0.04 | 2.17 | n/a | No Hit | |||
| PATZ1_HUMAN | n/a | 2.42 | 2.00 | n/a | No Hit | |||
| RFX5_HUMAN | n/a | 2.23 | 2.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg