rs12725494 chr1:203027461 A>G
- Sequence
aaggtgccactaggagctgatgtc[A/G]cctttgaggagaggtgtgctggta
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.14 | 0.56 | 1.99 | |||
| K562 (myelogenous leukemia) | 0.74 | -0.73 | 2.80 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Nucleus_accumbens_basal_ganglia, Esophagus_Mucosa, Esophagus_Muscularis, Skin_Sun_Exposed_Lower_leg