rs12736781 chr1:160582565 C>T
- Sequence
ccccagtgtgtgatgttctcctcc[C/T]tgtgtccatgtgttctcattgttc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- REQU_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| REQU_HUMAN | -0.89 | 1.89 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Nerve_Tibial, Stomach