rs12758915 chr1:226870643 A>G
- Sequence
taaactccgctggagcgcggcggc[A/G]gagcaggtgagcgggcggtgccgg
- ASB in cell types
- K562 (myelogenous leukemia) tibial nerve HEK293T (embryonic kidney)
- ASB for transcription factors
- HNRLL_HUMAN ZFX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HNRLL_HUMAN | n/a | 2.41 | 2.00 | n/a | n/a | |||
| ZFX_HUMAN | -0.52 | 0.64 | 1.86 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood