rs12771023 chr10:77227380 T>A
- Sequence
catgttttggcattaaccagtgac[T/A]cagaaggtactgccagatgcaaat
- ASB in cell types
- CLB-Ga (neuroblastoma)
- ASB for transcription factors
- HAND2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HAND2_HUMAN | -2.37 | 2.28 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, college completion, hdl cholesterol change with statins, total cholesterol change with statins, triglycerides, years of education