rs12773448 chr10:79150177 G>T
- Sequence
accctggcctggccccgggccgca[G/T]ccgtgcaggtcactaggcctcggc
- ASB in cell types
- upper lobe of left lung cranial neural crest cells
- ASB for transcription factors
- EP300_HUMAN AP2A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EP300_HUMAN | n/a | 2.94 | 2.00 | n/a | n/a | |||
| AP2A_HUMAN | 1.69 | -1.39 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2