rs12794507 chr11:7666074 C>T
- Sequence
ctcagcatgtccaggtgaggtggg[C/T]ggtaaggggtgtggtggccgtaag
- ASB in cell types
- MM1.S (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MM1.S (plasma cell myeloma) | 1.39 | -0.78 | 1.28 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Lung, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood