rs12815929 chr12:128824136 A>G
- Sequence
aggaggtggccggtattctggatc[A/G]ctgcgtgtcttggggagcttggga
- ASB in cell types
- HEK293 (embryonic kidney) MDA231-LM2-4175 (breast adenocarcinoma) HEK293T (embryonic kidney)
- ASB for transcription factors
- E2F1_HUMAN KLF9_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| E2F1_HUMAN | 2.58 | n/a | 2.00 | n/a | No Hit | |||
| KLF9_HUMAN | -2.13 | 2.21 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Cerebellum, Cells_Cultured_fibroblasts, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid