rs12858132 chr13:95404434 T>G
- Sequence
caagccagcagagcagctgctcgc[T/G]ccagagccgtggtgtcttcctggt
- ASB in cell types
- HEK293 (embryonic kidney) MCF10A (breast epithelial cells) erythroid cells MCF10CA1a (breast metastatic epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.29 | 1.13 | 2.31 | |||
| MCF10A (breast epithelial cells) | 1.75 | -2.03 | 1.33 | |||
| erythroid cells | 2.35 | n/a | 2.00 | |||
| MCF10CA1a (breast metastatic epithelial cells) | 1.47 | -1.74 | 1.33 | |||
| MCF10AT1 (breast premetastatic epithelial cells) | 1.17 | -1.46 | 1.33 |
Items per page:
1 – 5 of 5