rs12882114 chr14:22268804 A>G
- Sequence
tatctcctaggcagtcacgccaac[A/G]tgctggacaccactcgctgaaaat
- ASB in cell types
- HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.28 | 0.62 | 1.63 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.04 | 0.61 | 1.50 |
Items per page:
1 – 2 of 2