rs12890225 chr14:100240715 T>C
- Sequence
gccgttgccagcgaattcctggcc[T/C]tttcgccttcctgcggtacctagt
- ASB in cell types
- HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma) upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.95 | -0.15 | 1.93 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.62 | 0.10 | 1.49 | |||
| upper lobe of left lung | -0.80 | 1.16 | 1.00 |
Items per page:
1 – 3 of 3