rs12894609 chr14:95301043 T>C
- Sequence
cctgatgcactaagtaattttcca[T/C]gaagtaactttccaaaagggtcat
- ASB in cell types
- embryonic kidney
- ASB for transcription factors
- GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 1.48 | -0.94 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, cystatin c in serum, diastolic blood pressure (dbp), fasting insulin, late onset alzheimers disease, longstanding arthritis, mitral annular calcium, obesity with early age of onset (age >2), sporadic creutzfeldt-jakob disease