rs12897115 chr14:96100674 G>A
- Sequence
aaaatttgcctccggggcaattac[G/A]agttactgggcctagaaaatcagt
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.22 | 0.73 | 1.95 | |||
| foreskin keratinocyte | n/a | 0.60 | 2.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, asthma, homa-b, ldl cholesterol, mitral annular calcium, rheumatoid arthritis, total cholesterol change with statins