rs12900871 chr15:70386510 G>A
- Sequence
atctgtatactctgtcgtcagagc[G/A]gcaggcataatcaagttttcccaa
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- RFX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFX1_HUMAN | -0.10 | 1.59 | 1.42 | 1.51 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP college completion, hdl cholesterol change with statins, ldl cholesterol change with statins, salmonella-induced pyroptosis, total cholesterol change with statins, years of education