rs12901081 chr15:67078030 C>G
- Sequence
gctgttaacagcaggttttctgcc[C/G]gagttatccaggtcagagtcataa
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.42 | -0.08 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.26 | 0.43 | 1.32 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, aortic valve calcium, birth weight, coronary artery disease (cad), ldl cholesterol, lung function, forced expiratory volume in 1 second (fev1), total cholesterol