rs12921482 chr16:78045960 G>A
- Sequence
ccagggaaggacaggccgggcaat[G/A]ggcgcggagacgaaggggccggac
- ASB in cell types
- HEK293 (embryonic kidney) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.19 | 0.84 | 1.74 | |||
| A549 (lung carcinoma) | 0.29 | 1.74 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellum, Brain_Hypothalamus, Brain_Putamen_basal_ganglia, Prostate, Testis