rs12933191 chr16:85461781 T>C
- Sequence
gcctggccagccagcctcactaga[T/C]ctcctgcagctcccctattccatc
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.60 | 1.12 | 2.77 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.60 | -0.10 | 1.70 |
Items per page:
1 – 2 of 2