rs12944746 chr17:8794225 T>C
- Sequence
gatgctaatggtgactacgtccta[T/C]gattacttgatgagctagtacgcg
- ASB in cell types
- LHSAR (prostate epithelial cells) VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LHSAR (prostate epithelial cells) | 1.43 | -1.01 | 1.50 | |||
| VCaP (prostate carcinoma) | -0.07 | 0.71 | 1.59 |
Items per page:
1 – 2 of 2