rs12945884 chr17:66304163 T>C
- Sequence
ttaactcggagggtccctgggggc[T/C]tatggagaatcgatacatagaagg
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.59 | -0.19 | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.71 | -0.12 | 1.70 |
Items per page:
1 – 2 of 2