rs12946392 chr17:43576728 G>A
- Sequence
aatgcgtgtccgttgtagaacggg[G/A]tggggtgggcagggggcgtgtgtc
- ASB in cell types
- IPSC-derived bipolar neuron GM23338 MCF10AT1 (breast premetastatic epithelial cells) MCF10A (breast epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| IPSC-derived bipolar neuron | -0.33 | 1.36 | 1.00 | |||
| GM23338 | -0.60 | 1.29 | 1.33 | |||
| MCF10AT1 (breast premetastatic epithelial cells) | -1.54 | 1.83 | 1.33 | |||
| MCF10A (breast epithelial cells) | -1.28 | 1.65 | 1.33 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Amygdala, Brain_Cerebellum, Brain_Hypothalamus, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid