rs12948391 chr17:28948603 T>C
- Sequence
agtttcctacataacttctgacca[T/C]aaacttaatttgctcagtatcagt
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- PRDM6_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRDM6_HUMAN | -2.43 | 2.01 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, comorbid depressive syndrome and alcohol dependence, ldl cholesterol, mean corpuscular hemoglobin concentration (mchc), parkinsons disease, refractive error, total cholesterol