rs1296022 chr8:11864846 G>A
- Sequence
gaacattgcttgaacctgggaggt[G/A]aggttgcagtgagctgagattgtg
- ASB in cell types
- HEK293 (embryonic kidney) HepG2 (hepatoblastoma) liver
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.92 | -0.03 | 1.83 | |||
| HepG2 (hepatoblastoma) | 0.58 | 0.21 | 1.31 | |||
| liver | 1.01 | -0.14 | 1.33 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid, Whole_Blood